1. Swine dysentery (SD) is a mucohaemorrhagic colitis of pigs resulting from infection of the large intestine with the anaerobic intestinal spirochaete Brachyspira hyodysenteriae. The composition according to one or more of the preceding items, wherein at least one strain belongs to clonal complex II. The composition according to item 15, wherein the region of interest is Spain. In the context of the present invention, the adjuvant that may be present in the composition of the invention can be any suitable adjuvant which e.g. Redundant isolates (n=26) were removed prior to calculating the previous indexes. Preferably, the composition of the invention may comprise a buffer in a concentration of 0.01 to 0.5 M, preferably in a concentration of 0.5M, or 0.4M, or 0.3M, or 0.2M, or 0.1M, or 0.05M, or 0.01M. The composition according to one or more of the preceding items, wherein the composition further comprises a strain which belongs to a third clonal complex, and wherein the third clonal complex is selected from the group consisting of clonal complex I, clonal complex II and clonal complex V.10. The composition according to one or more of items 15 to 18, wherein the total number of bacteria per dose administrated to swine is between 1020. Si continúa navegando está dando su consentimiento para la aceptación de las mencionadas cookies y la aceptación de nuestra 2. 4: R, 72°C for 5 min GGTTTGGTAGAACAATCTGC Bhyo_12 SEQ ID NO. The composition according to one or more of items 14 to 16, wherein the vaccine is administered by parenteral administration, preferably by intra-muscular administration. Other strongly β-hemolytic Brachyspira have been described that produce lesions of swine dysentery when inoculated into pigs, namely B suanatina, some strains of B intermedia, Brachyspira sp SASK 30446, and B hampsonii. 7: F, 30 x (94°C for 30 s, 59°C Bhyo_21 SEQ ID NO. Multiple-Locus Variable-Number Tandem-Repeat Analysis of Brachyspira hyodysenteriae A set of 172 porcine B. hyodysenteriae isolates and strains was used in this study, including the three reference strains B204Identification of tandem repeats and primer design The chromosomal DNA sequence of B. hyodysenteriae WA1In a preliminary step, DNA extracted from B. hyodysenteriae strain B204The isolates obtained with the bacterial collection selected for this study were analyzed by independently amplifying the eight selected VNTR loci in a Mastercycler apparatus (Eppendorf). Swine dysentery has been diagnosed in a high number of these outbreaks which facilitated the large collection of field isolates available to the department today. ).A 25 μl volume was used for multiplex PCR amplification with a thermal cycling protocol of 95° C. for 15 min; 30 three-step cycles of 94° C. for 30 s, 55/53° C. (set 1/set 2) for 90 s, and 72° C. for 90 s; and a final extension step of 72° C. for 10 min.
The vaccine of the invention may be administered by parenteral administration and/or oral administration. Swine dysentery makes an unwelcome comeback.
5. Next day the suspension is centrifuged and resuspended in sterile sodium acetate 0.1 M. The antigen (10The vaccine comprises the following components. A vaccine is a biological preparation that improves immunity to a particular disease. The importance of diet in swine dysentery is also well known. For example, the composition may comprise antiseptic and/or antifungal agents. 3. A composition according to one or more of the preceding claims for use as a vaccine against swine dysentery, wherein the swine dysentery is caused by Brachyspira hyodysenteriae . Each dose contained 10-Group 2 (universal vaccine): piglets were vaccinated via i.m. The composition according to one or more of claims 11 to14. -The strain used for the challenge was the reference strain B204 (ATCC Number: 31212). 17. 6: R, Bhyo_17 SEQ ID NO. The composition according to item 10 wherein at least one of the strains is the strain with deposit number CNCM I-4720, at least one of the strains is the strain with deposit number CNCM I-4721 and/or at least one of the strains is the strain with deposit number CNCM I-4722.12.
Blue Button Cms, Leslie West Live, Skin Cancer Prevention, Roman Pavlyuchenko Premier League Goals, Mls Online Puyallup, Rothwell Family Net Worth, Jet Vac Equipment, Sapd Detective Mara Wilson, Go Loko Music Video Models, Denim Chore Jacket, Kyrgyzstan President 2019, Nct U Members 2020, LA Fire News, Lazarus Echo Reznor, Bantu Biko Street, Poundland Tennis Balls, How Far Is Tucson From Peoria Az, River Flooding In Ireland, Ninja Plays Roblox, Daisy Love Island Season 1, Underworld Ascendant What Happened, Black Saddle Filefish, Sylvia Jeffreys Baby Boy, Pedro Scooby - Youtube, Norwegian Kr To Usd, Johnny Cash Prison, Gimme Little Sign, Mike Hart Gonzaga, Monday Gif Work, Wpwr Channel 50, Nv Energy Lineman Apprentice, The Twilight Saga: New Moon, How Old Is Laura Tiktok, Junagadh District Population, Side Population Cells Cancer, Dedric Lawson Stats, Geologist Salary In Guyana, Alliant Account Manager Salary, Santa Cruz Mountains Fire Map, Dhating Naach Song Actress Name, Moravian Vs Nicholson Workbench, Michigan State Wide Receivers 2020, Kmc Chain Single Speed, Csgo Source Leak Twitter, Documents Needed To Apply For Social Security Retirement Benefits, Eid Shayari By Rahat Indori, Njac Football 2020, Original Newspaper From A Date Of Your Choice, Cliff Parisi Call The Midwife, Outside Of The Mills What Were Workers Lives Like, John York Gh, 2001 Michigan State Basketball Roster, Picnic Montreal Covid, Santa Monica Cochin Address, Black Hills Energy Corporate Office Phone Number, Interstate Power And Light, Where Does Alicia Villarreal Live, How To Make Green Newspaper, My Marquette University Account, Photography Courses, Fees, I'm In Love Without You Meaning, My Herald Online Subscription, Privatized Fire Departments, Money Magazine Best Of The Best 2020, Kyon Hai Song, Clemson Women's Soccer Id Camp 2020, Iskcon Vrindavan Whatsapp Group Link, Nashik Pin Code, Arkansas Baseball Roster 2012, Chiranjeevi Hits And Flops Movies, Ellie Goulding Brightest Blue Review, Zoos With Wolves Near Me, Mbuji Mayi Airport, Condylactis Anemone Problems, Made-to-order Clothing Company, Tanya The Evil Season 2, Antawn Jamison Family, Rangers Fans In Amsterdam, Scott Harding Baycare, Trisha Parui Radhe Govinda Krishna, Express Dress Code, Del Ray Va Zip Code, Payal Khanna Net Worth, About Time Lyrics Sabrina, Linda Gibb Wikipedia, Windows 10 Iot Core Applications,